Skip to main content
Addgene

pCAG-EGFP/RFP-int
(Plasmid #19818)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 19818 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pZ/AP
  • Backbone size (bp) 8200
  • Vector type
    Mammalian Expression, RNAi, Cre/Lox

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    empty vector

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AsiSI (not destroyed)
  • 3′ cloning site MluI (not destroyed)
  • 5′ sequencing primer GCTGGACATCACCTCCCACAACG
  • 3′ sequencing primer ACAGGAGGTGGGGAGCAGGAGA
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The lacZ and the human placental alkaline phosphatase (AP) genes in the pZ/AP vector were replaced with EGFP, synthesized by PCR from pEGFP-N1 (Clontech), and RFP, synthesized by PCR from pDsRed2-C1 (Clontech), respectively. One cryptic start codon at the 5'UTR of the original AP gene that was not in frame was eliminated. These modifications produced a conditional vector for miRNA expression, pCAG-EGFP/RFP. A synthetic artificial intron was designed to contain typical intron splicing regulatory elements. This intron was placed 10 nt-downstream of the stop codon of the RFP gene to avoid NMD.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCAG-EGFP/RFP-int was a gift from Zuoshang Xu (Addgene plasmid # 19818 ; http://n2t.net/addgene:19818 ; RRID:Addgene_19818)
  • For your References section:

    A construct with fluorescent indicators for conditional expression of miRNA. Qiu L, Wang H, Xia X, Zhou H, Xu Z. BMC Biotechnol. 2008 Oct 7;8:77. doi: 10.1186/1472-6750-8-77. 10.1186/1472-6750-8-77 PubMed 18840295