pSF-NgPglO
(Plasmid
#198204)
-
PurposepSN18 derivative encoding N. gonorrhoeae PglO with C-terminal FLAG epitope tag
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 198204 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepSF (pSN18 derivative)
- Backbone size w/o insert (bp) 3987
- Total vector size (bp) 5841
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameNgPglO
-
SpeciesN. gonorrhoeae
-
Insert Size (bp)1854
- Promoter pBAD
-
Tag
/ Fusion Protein
- Flag tag (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ATGCCATAGCATTTTTATCC
- 3′ sequencing primer GATTTAATCTGTATCAGG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bypSF backbone is from Ollis, et al. doi.org/10.1038/srep15237
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Addgene's NGS results found a K479E mutation in NgPglO insert that will not affect plasmid function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSF-NgPglO was a gift from Michael Jewett (Addgene plasmid # 198204 ; http://n2t.net/addgene:198204 ; RRID:Addgene_198204) -
For your References section:
Improving cell-free glycoprotein synthesis by characterizing and enriching native membrane vesicles. Hershewe JM, Warfel KF, Iyer SM, Peruzzi JA, Sullivan CJ, Roth EW, DeLisa MP, Kamat NP, Jewett MC. Nat Commun. 2021 Apr 22;12(1):2363. doi: 10.1038/s41467-021-22329-3. 10.1038/s41467-021-22329-3 PubMed 33888690