pJL1-AcrA
(Plasmid
#198214)
-
PurposepJL1 plasmid encoding wildtype AcrA from C. jejuni containing 2 native internal glycosylation sites recognized by PglB and a C-terminal 6x-His tag
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 198214 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepJL1
- Backbone size w/o insert (bp) 1833
- Total vector size (bp) 2892
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAcrA
-
Insert Size (bp)1059
- Promoter T7
-
Tag
/ Fusion Protein
- 6x His tag (C terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer GCTAGTTATTGCTCAGCGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJL1-AcrA was a gift from Michael Jewett (Addgene plasmid # 198214 ; http://n2t.net/addgene:198214 ; RRID:Addgene_198214) -
For your References section:
Improving cell-free glycoprotein synthesis by characterizing and enriching native membrane vesicles. Hershewe JM, Warfel KF, Iyer SM, Peruzzi JA, Sullivan CJ, Roth EW, DeLisa MP, Kamat NP, Jewett MC. Nat Commun. 2021 Apr 22;12(1):2363. doi: 10.1038/s41467-021-22329-3. 10.1038/s41467-021-22329-3 PubMed 33888690