Skip to main content

pJL1-PD-DQNAT
(Plasmid #198216)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 198216 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pJL1
  • Backbone size w/o insert (bp) 1762
  • Total vector size (bp) 2848
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    PD-DQNAT
  • Species
    H. influenzae
  • Insert Size (bp)
    1086
  • Promoter T7
  • Tags / Fusion Proteins
    • 6x His Tag (C terminal on insert)
    • DQNAT glycosylation tag (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer GCTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJL1-PD-DQNAT was a gift from Michael Jewett (Addgene plasmid # 198216 ; http://n2t.net/addgene:198216 ; RRID:Addgene_198216)
  • For your References section:

    Improving cell-free glycoprotein synthesis by characterizing and enriching native membrane vesicles. Hershewe JM, Warfel KF, Iyer SM, Peruzzi JA, Sullivan CJ, Roth EW, DeLisa MP, Kamat NP, Jewett MC. Nat Commun. 2021 Apr 22;12(1):2363. doi: 10.1038/s41467-021-22329-3. 10.1038/s41467-021-22329-3 PubMed 33888690