Skip to main content

pCAG-RFP-int
(Plasmid #19822)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 19822 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pZ/AP
  • Backbone size (bp) 6300
  • Vector type
    Mammalian Expression, RNAi

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    empty vector

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AsiSI (not destroyed)
  • 3′ cloning site MluI (not destroyed)
  • 5′ sequencing primer GCTGGACATCACCTCCCACAACG
  • 3′ sequencing primer ACAGGAGGTGGGGAGCAGGAGA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCAG-RFP-int was a gift from Zuoshang Xu (Addgene plasmid # 19822 ; http://n2t.net/addgene:19822 ; RRID:Addgene_19822)
  • For your References section:

    A construct with fluorescent indicators for conditional expression of miRNA. Qiu L, Wang H, Xia X, Zhou H, Xu Z. BMC Biotechnol. 2008 Oct 7;8:77. doi: 10.1186/1472-6750-8-77. 10.1186/1472-6750-8-77 PubMed 18840295