pCENPTΔC-dCas9-3xGFP
(Plasmid
#198325)
-
PurposeExpresses CENPTΔC-dCas9-3xGFP protein in mammalian cells. When coupled with a guide RNA against a high repeat target locus, this can be applied to seed ectopic kinetochores at the target locus
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 198325 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepHAGE-TO-dCas9-3XGFP
-
Backbone manufacturerAddgene
- Backbone size w/o insert (bp) 12986
- Total vector size (bp) 14183
-
Modifications to backbonenone
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCENPTΔC
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1125
-
Mutationtruncation - encodes only amino acids 1-375
-
Entrez GeneCENPT (a.k.a. C16orf56, CENP-T, SSMGA)
- Promoter CMV-TetO
-
Tags
/ Fusion Proteins
- dCas9 (C terminal on insert)
- EGFP x 3 (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer ccaatggagtacttcttgtc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byCloned from addgene plasmid 45109
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
CENPTdC was amplified by PCR from Addgene plasmid #45109, using FWD primer: GCCGCCGAATTCGGTGGAGGCGGATCAGGGGGAGGAGGTAGTgagatggcagaccacaac and REV primer: GCCGCCgaattcGCTTCCACCTCCACCTGAACCACCACCGCCttccccttggcttccttc. These primers added 2 X Gly4Ser inter-domain linkers to sit between the CENPTdC and dCas9 domains of the fusion protein, as well as the EcoRI sites for subcloning into the backbone.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCENPTΔC-dCas9-3xGFP was a gift from Sarah McClelland (Addgene plasmid # 198325 ; http://n2t.net/addgene:198325 ; RRID:Addgene_198325) -
For your References section:
Targeted assembly of ectopic kinetochores to induce chromosome-specific segmental aneuploidies. Tovini L, Johnson SC, Guscott MA, Andersen AM, Spierings DCJ, Wardenaar R, Foijer F, McClelland SE. EMBO J. 2023 May 15;42(10):e111587. doi: 10.15252/embj.2022111587. Epub 2023 Apr 17. 10.15252/embj.2022111587 PubMed 37063065