Skip to main content

pCENPTΔC-dCas9-3xGFP
(Plasmid #198325)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 198325 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pHAGE-TO-dCas9-3XGFP
  • Backbone manufacturer
    Addgene
  • Backbone size w/o insert (bp) 12986
  • Total vector size (bp) 14183
  • Modifications to backbone
    none
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    CENPTΔC
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1125
  • Mutation
    truncation - encodes only amino acids 1-375
  • Entrez Gene
    CENPT (a.k.a. C16orf56, CENP-T, SSMGA)
  • Promoter CMV-TetO
  • Tags / Fusion Proteins
    • dCas9 (C terminal on insert)
    • EGFP x 3 (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer ccaatggagtacttcttgtc
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Cloned from addgene plasmid 45109

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

CENPTdC was amplified by PCR from Addgene plasmid #45109, using FWD primer: GCCGCCGAATTCGGTGGAGGCGGATCAGGGGGAGGAGGTAGTgagatggcagaccacaac and REV primer: GCCGCCgaattcGCTTCCACCTCCACCTGAACCACCACCGCCttccccttggcttccttc. These primers added 2 X Gly4Ser inter-domain linkers to sit between the CENPTdC and dCas9 domains of the fusion protein, as well as the EcoRI sites for subcloning into the backbone.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCENPTΔC-dCas9-3xGFP was a gift from Sarah McClelland (Addgene plasmid # 198325 ; http://n2t.net/addgene:198325 ; RRID:Addgene_198325)
  • For your References section:

    Targeted assembly of ectopic kinetochores to induce chromosome-specific segmental aneuploidies. Tovini L, Johnson SC, Guscott MA, Andersen AM, Spierings DCJ, Wardenaar R, Foijer F, McClelland SE. EMBO J. 2023 May 15;42(10):e111587. doi: 10.15252/embj.2022111587. Epub 2023 Apr 17. 10.15252/embj.2022111587 PubMed 37063065