PB-Ef1a-SunTag-RPS7-PP7-WPRE
(Plasmid
#198338)
-
PurposePB plasmid expressing RPS7 mRNA tagged with SunTag repeats and PP7 stem loops
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 198338 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneL50
-
Backbone manufacturerin house
- Backbone size w/o insert (bp) 5891
- Total vector size (bp) 10118
-
Vector typeMammalian Expression ; PiggyBac
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameGCN4x24-RPS7-3'UTR-PP7 stem loops x24
-
Alt nameSunTag-RPS7-PP7
-
SpeciesH. sapiens (human), Synthetic
-
Insert Size (bp)4325
- Promoter Ef1a
-
Tags
/ Fusion Proteins
- SunTag (N terminal on insert)
- PP7 stem loops (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TCAAGCCTCAGACAGTGGTTC
- 3′ sequencing primer AATTGTCAGTGCCCAACAGC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PB-Ef1a-SunTag-RPS7-PP7-WPRE was a gift from Michael Ward (Addgene plasmid # 198338 ; http://n2t.net/addgene:198338 ; RRID:Addgene_198338) -
For your References section:
Messenger RNA transport on lysosomal vesicles maintains axonal mitochondrial homeostasis and prevents axonal degeneration. Ryan V, et al.. Nature Neuroscience, 2024 10.1038/s41593-024-01619-1