-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 19834 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepWzl-hygro
-
Backbone manufacturerScott Lowe
- Backbone size w/o insert (bp) 5600
-
Vector typeRetroviral
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTelomere-Repeat binding Factor 1
-
Alt nameTerf1
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1300
-
Entrez GeneTerf1 (a.k.a. Pin2, Trbf1, Trf1)
-
Tag
/ Fusion Protein
- enhanced GFP (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 3′ cloning site Bgl II (destroyed during cloning)
- 5′ sequencing primer CCTTTGTACACCCTAAGCCT
- 3′ sequencing primer AATGCTCGTCAAGAAGAC (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
eGFP-TRF1 pWzl-Hygro was a gift from Titia de Lange (Addgene plasmid # 19834 ; http://n2t.net/addgene:19834 ; RRID:Addgene_19834) -
For your References section:
53BP1 promotes non-homologous end joining of telomeres by increasing chromatin mobility. Dimitrova N, Chen YC, Spector DL, de Lange T. Nature. 2008 Nov 27;456(7221):524-8. doi: 10.1038/nature07433. Epub 2008 Oct 19. 10.1038/nature07433 PubMed 18931659