Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

eGFP-TRF1 pWzl-Hygro
(Plasmid #19834)

Loading...

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 19834 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pWzl-hygro
  • Backbone manufacturer
    Scott Lowe
  • Backbone size w/o insert (bp) 5600
  • Vector type
    Retroviral
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Telomere-Repeat binding Factor 1
  • Alt name
    Terf1
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1300
  • Entrez Gene
    Terf1 (a.k.a. Pin2, Trbf1, Trf1)
  • Tag / Fusion Protein
    • enhanced GFP (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 3′ cloning site Bgl II (destroyed during cloning)
  • 5′ sequencing primer CCTTTGTACACCCTAAGCCT
  • 3′ sequencing primer AATGCTCGTCAAGAAGAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    eGFP-TRF1 pWzl-Hygro was a gift from Titia de Lange (Addgene plasmid # 19834 ; http://n2t.net/addgene:19834 ; RRID:Addgene_19834)
  • For your References section:

    53BP1 promotes non-homologous end joining of telomeres by increasing chromatin mobility. Dimitrova N, Chen YC, Spector DL, de Lange T. Nature. 2008 Oct 19. ():. 10.1038/nature07433 PubMed 18931659