pCRISPR Human CASP9 -2
(Plasmid
#198420)
-
PurposeExpresses Human CASP9 Specific gRNA/Cas9 Complex and Reporter Protein
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 198420 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneGeneArt CRISPR Nuclease OFP Vector Linearized
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 9219
- Total vector size (bp) 9239
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHuman CASP9 Specific gRNA
-
Alt nameCASP-9; ICE-LAP6; Mch6; APAF-3
-
gRNA/shRNA sequenceACCAGAGATTCGCAAACCAG
-
SpeciesH. sapiens (human)
-
GenBank IDNM_001229
-
Entrez GeneCASP9 (a.k.a. APAF-3, APAF3, ICE-LAP6, MCH6, PPP1R56)
- Promoter U6; CMV
-
Tag
/ Fusion Protein
- Cas9/Orange Fluorescent Protein Reporter (C terminal on backbone)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer GGACTATCATATGCTTACCG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCRISPR Human CASP9 -2 was a gift from Hannah Rabinowich (Addgene plasmid # 198420 ; http://n2t.net/addgene:198420 ; RRID:Addgene_198420) -
For your References section:
Involvement of CASP9 (caspase 9) in IGF2R/CI-MPR endosomal transport. Han J, Goldstein LA, Hou W, Watkins SC, Rabinowich H. Autophagy. 2021 Jun;17(6):1393-1409. doi: 10.1080/15548627.2020.1761742. Epub 2020 May 25. 10.1080/15548627.2020.1761742 PubMed 32397873