-
PurposeE. coli protein expression plasmid encoding hyperactive Tn5 transposase fused to protein G, in T7 Express lysY/Iq protein expression strain.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 198468 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepETv2
- Backbone size w/o insert (bp) 5234
- Total vector size (bp) 6986
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB C3013 T7 Express lysY/Iq
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert name10His-pG-Tn5 (E54K, L372P)
-
Alt nameTn5
-
Alt nameOpenTn5
-
SpeciesSynthetic
-
Insert Size (bp)1752
-
MutationE54K, L372P
- Promoter Consensus φ10 T7 Promoter
-
Tag
/ Fusion Protein
- 10His-pG (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TAATACGACTCACTATAGGG
- (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2024.07.11.602973v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
VR124 pETv2 10His-pG-Tn5 (E54K, L372P) was a gift from Viviana Risca (Addgene plasmid # 198468 ; http://n2t.net/addgene:198468 ; RRID:Addgene_198468) -
For your References section:
OpenTn5: Open-Source Resource for Robust and Scalable Tn5 Transposase Purification and Characterization. Soroczynski J, Anderson LJ, Yeung JL, Rendleman JM, Oren DA, Konishi HA, Risca VI. bioRxiv [Preprint]. 2024 Jul 13:2024.07.11.602973. doi: 10.1101/2024.07.11.602973. 10.1101/2024.07.11.602973 PubMed 39026714