VR124 pETv2 10His-pG-Tn5 (E54K, L372P)
(Plasmid
#198468)
-
PurposeE. coli protein expression plasmid encoding hyperactive Tn5 transposase fused to protein G, in T7 Express lysY/Iq protein expression strain.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 198468 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepETv2
- Backbone size w/o insert (bp) 5234
- Total vector size (bp) 6986
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB C3013 T7 Express lysY/Iq
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert name10His-pG-Tn5 (E54K, L372P)
-
Alt nameTn5
-
Alt nameOpenTn5
-
SpeciesSynthetic
-
Insert Size (bp)1752
-
MutationE54K, L372P
- Promoter Consensus φ10 T7 Promoter
-
Tag
/ Fusion Protein
- 10His-pG (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TAATACGACTCACTATAGGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
VR124 pETv2 10His-pG-Tn5 (E54K, L372P) was a gift from Viviana Risca (Addgene plasmid # 198468 ; http://n2t.net/addgene:198468 ; RRID:Addgene_198468)