Skip to main content

Lenti-guide-puro mCsnk2b - 1
(Plasmid #198505)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 198505 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    lenti-guide puro
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mCsnk2b
  • gRNA/shRNA sequence
    GGGGCAGTAGAGTTTCACCA
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    20
  • Entrez Gene
    Csnk2b (a.k.a. CK II beta)
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)
  • 3′ cloning site Unknown (unknown if destroyed)
  • 5′ sequencing primer gcctatttcccatgattccttc
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Lenti-guide-puro mCsnk2b - 1 was a gift from Suzanne Pfeffer (Addgene plasmid # 198505 ; http://n2t.net/addgene:198505 ; RRID:Addgene_198505)
  • For your References section:

    Genome-wide screen reveals Rab12 GTPase as a critical activator of Parkinson's disease-linked LRRK2 kinase. Dhekne HS, Tonelli F, Yeshaw WM, Chiang CY, Limouse C, Jaimon E, Purlyte E, Alessi DR, Pfeffer SR. Elife. 2023 Oct 24;12:e87098. doi: 10.7554/eLife.87098. 10.7554/eLife.87098 PubMed 37874635