Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pAAV_EF1a-DIO-PdCO-mScarlet-ER-miniWPRE
(Plasmid #198516)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 198516 Standard format: Plasmid sent in bacteria as agar stab 1 $85
AAV1 198516-AAV1 Virus (100 µL at titer ≥ 7 × 10¹² vg/mL) and Plasmid. $405
AAV5 198516-AAV5 Virus (100 µL at titer ≥ 7 × 10¹² vg/mL) and Plasmid. $405

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pAAV
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 4993
  • Total vector size (bp) 6829
  • Modifications to backbone
    directional Cre-lox sites
  • Vector type
    Mammalian Expression, AAV, Cre/Lox

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    PdCO
  • Alt name
    Platynereis dumerilii Ciliary Opsin, optimized for mammalian neuron expression and enhanced axonal membrane trafficking
  • Species
    Synthetic; Platynereis dumerilii
  • Insert Size (bp)
    1896
  • GenBank ID
    AY692353.1
  • Promoter EF-1a
  • Tags / Fusion Proteins
    • mScarlet (C terminal on insert)
    • Rho1D4 (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SgsI (not destroyed)
  • 3′ cloning site NheI (not destroyed)
  • 5′ sequencing primer EF1a_F (tgccctttttgagtttggatcttggt)
  • 3′ sequencing primer minWPRE_R (gtccgcacgtgctttaaaaaac)
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Information for AAV1 (Catalog # 198516-AAV1) ( Back to top)

Purpose

Ready-to-use AAV1 particles produced from pAAV_EF1a-DIO-PdCO-mScarlet-ER-miniWPRE (#198516). In addition to the viral particles, you will also receive purified pAAV_EF1a-DIO-PdCO-mScarlet-ER-miniWPRE plasmid DNA.

Ef1a-driven, Cre-dependent expression of the optimized opsin PdCO in frame with mScarlet. These AAV preparations are suitable purity for injection into animals.

Delivery

  • Volume 100 µL
  • Titer ≥ 7 × 10¹² vg/mL
  • Pricing $375 USD for preparation of 100 µL virus + $30 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV1 cap gene
  • Buffer PBS + 0.001% Pluronic F-68 + 200 mM NaCl
  • Serotype AAV1
  • Purification Iodixanol gradient ultracentrifugation
  • Reporter Gene mScarlet

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Terms and Licenses

Viral Quality Control

Quality Control:
  • Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
  • Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.

Visit our viral production page for more information.

Addgene Comments

Using FLEX vectors in vivo: LoxP sites in FLEX plasmids are known to recombine during DNA amplification and viral vector production, which may result in a minority of Cre-activated (i.e., "flipped") viral vectors. Addgene has measured this occurs in 0.1-0.8% of viral particles in our typical production protocol. This can lead to a small number of cells exhibiting Cre-independent transgene expression in vivo. To address this, it is necessary to optimize the injection volume and viral titer to find the optimal AAV dosage required for Cre-dependent transgene expression and function in vivo. This may include reducing the viral particle dosage in order to reduce the likelihood of Cre-independent expression.

Information for AAV5 (Catalog # 198516-AAV5) ( Back to top)

Purpose

Ready-to-use AAV5 particles produced from pAAV_EF1a-DIO-PdCO-mScarlet-ER-miniWPRE (#198516). In addition to the viral particles, you will also receive purified pAAV_EF1a-DIO-PdCO-mScarlet-ER-miniWPRE plasmid DNA.

Ef1a-driven, Cre-dependent expression of the optimized opsin PdCO in frame with mScarlet. These AAV preparations are suitable purity for injection into animals.

Delivery

  • Volume 100 µL
  • Titer ≥ 7 × 10¹² vg/mL
  • Pricing $375 USD for preparation of 100 µL virus + $30 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV5 cap gene
  • Buffer PBS + 0.001% Pluronic F-68 + 200 mM NaCl
  • Serotype AAV5
  • Purification Iodixanol gradient ultracentrifugation
  • Reporter Gene mScarlet

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Terms and Licenses

Viral Quality Control

Quality Control:
  • Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
  • Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.

Visit our viral production page for more information.

Addgene Comments

Using FLEX vectors in vivo: LoxP sites in FLEX plasmids are known to recombine during DNA amplification and viral vector production, which may result in a minority of Cre-activated (i.e., "flipped") viral vectors. Addgene has measured this occurs in 0.1-0.8% of viral particles in our typical production protocol. This can lead to a small number of cells exhibiting Cre-independent transgene expression in vivo. To address this, it is necessary to optimize the injection volume and viral titer to find the optimal AAV dosage required for Cre-dependent transgene expression and function in vivo. This may include reducing the viral particle dosage in order to reduce the likelihood of Cre-independent expression.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV_EF1a-DIO-PdCO-mScarlet-ER-miniWPRE was a gift from Ofer Yizhar (Addgene plasmid # 198516 ; http://n2t.net/addgene:198516 ; RRID:Addgene_198516) For viral preps, please replace (Addgene plasmid # 198516) in the above sentence with: (Addgene viral prep # 198516-AAV1) or (Addgene viral prep # 198516-AAV5)
  • For your References section:

    A bistable inhibitory optoGPCR for multiplexed optogenetic control of neural circuits. Wietek J, Nozownik A, Pulin M, Saraf-Sinik I, Matosevich N, Gowrishankar R, Gat A, Malan D, Brown BJ, Dine J, Imambocus BN, Levy R, Sauter K, Litvin A, Regev N, Subramaniam S, Abrera K, Summarli D, Goren EM, Mizrachi G, Bitton E, Benjamin A, Copits BA, Sasse P, Rost BR, Schmitz D, Bruchas MR, Soba P, Oren-Suissa M, Nir Y, Wiegert JS, Yizhar O. Nat Meth. 2024 May 29. doi: 10.1038/s41592-024-02285-8 10.1038/s41592-024-02285-8 PubMed 37425961