pCI-neo-(HA)3-ε
(Plasmid
#198531)
-
PurposeExpression of HA-tagged AP-4 ε in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 198531 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepCI-neo
- Backbone size w/o insert (bp) 5474
- Total vector size (bp) 8971
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameAP-4 ε
-
SpeciesH. sapiens (human)
-
Insert Size (bp)3522
-
Mutationsilent substitutions in codons 235, 262, 905 and 1129
-
Entrez GeneAP4E1 (a.k.a. CPSQ4, SPG51, STUT1)
- Promoter CMV
-
Tag
/ Fusion Protein
- triple HA tag (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer pCI-neo forward: 5’ CTCTCCACAGGTGTCCACTCCCAGTTC
- 3′ sequencing primer pCI-neo reverse: 5’ CACTGCATTCTAGTTGTGGTTTGTCCAAACTCATC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
triple HA tag subcloned between XhoI and EcoRI sites, AP-4 ε subcloned betwen EcoRI and SalI sites; all sites are intact
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCI-neo-(HA)3-ε was a gift from Juan Bonifacino (Addgene plasmid # 198531 ; http://n2t.net/addgene:198531 ; RRID:Addgene_198531) -
For your References section:
AP-4 mediates export of ATG9A from the trans-Golgi network to promote autophagosome formation. Mattera R, Park SY, De Pace R, Guardia CM, Bonifacino JS. Proc Natl Acad Sci U S A. 2017 Dec 12;114(50):E10697-E10706. doi: 10.1073/pnas.1717327114. Epub 2017 Nov 27. 10.1073/pnas.1717327114 PubMed 29180427