Skip to main content
Addgene

pCI-neo-(HA)3-ε
(Plasmid #198531)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 198531 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCI-neo
  • Backbone size w/o insert (bp) 5474
  • Total vector size (bp) 8971
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    AP-4 ε
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    3522
  • Mutation
    silent substitutions in codons 235, 262, 905 and 1129
  • Entrez Gene
    AP4E1 (a.k.a. CPSQ4, SPG51, STUT1)
  • Promoter CMV
  • Tag / Fusion Protein
    • triple HA tag (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer pCI-neo forward: 5’ CTCTCCACAGGTGTCCACTCCCAGTTC
  • 3′ sequencing primer pCI-neo reverse: 5’ CACTGCATTCTAGTTGTGGTTTGTCCAAACTCATC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

triple HA tag subcloned between XhoI and EcoRI sites, AP-4 ε subcloned betwen EcoRI and SalI sites; all sites are intact

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCI-neo-(HA)3-ε was a gift from Juan Bonifacino (Addgene plasmid # 198531 ; http://n2t.net/addgene:198531 ; RRID:Addgene_198531)
  • For your References section:

    AP-4 mediates export of ATG9A from the trans-Golgi network to promote autophagosome formation. Mattera R, Park SY, De Pace R, Guardia CM, Bonifacino JS. Proc Natl Acad Sci U S A. 2017 Dec 12;114(50):E10697-E10706. doi: 10.1073/pnas.1717327114. Epub 2017 Nov 27. 10.1073/pnas.1717327114 PubMed 29180427