psiCHECK c14orf28 3'UTR
(Plasmid
#19856)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 19856 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepsiCHECK-2
-
Backbone manufacturerPromega
- Backbone size w/o insert (bp) 6249
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namec14orf28 3'UTR
-
Alt nameC14orf28
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1665
-
GenBank IDNM_001017923
-
Entrez GeneC14orf28 (a.k.a. DRIP-1, DRIP1, c14_5270)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer GTACATCAAGAGCTTCGTGG
- 3′ sequencing primer AAGACTCATTTAGATCCTCACAC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
There are small differences between author's sequence and Addgene sequence. Depositor is aware of the changes. These changes in the sequence do not affect the function of the construct.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
psiCHECK c14orf28 3'UTR was a gift from Thomas Tuschl (Addgene plasmid # 19856 ; http://n2t.net/addgene:19856 ; RRID:Addgene_19856) -
For your References section:
Molecular characterization of human Argonaute-containing ribonucleoprotein complexes and their bound target mRNAs. Landthaler M, Gaidatzis D, Rothballer A, Chen PY, Soll SJ, Dinic L, Ojo T, Hafner M, Zavolan M, Tuschl T. RNA. 2008 Dec;14(12):2580-96. doi: 10.1261/rna.1351608. Epub 2008 Oct 31. 10.1261/rna.1351608 PubMed 18978028