PAM3
(Plasmid
#198742)
-
PurposepTPBF-GFP, Geneticin resistance
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 198742 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonePAM3
- Backbone size w/o insert (bp) 5667
- Total vector size (bp) 5667
-
Vector typeAcanthamoeba expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameGFP
-
Insert Size (bp)720
- Promoter pTPBF
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BglII (not destroyed)
- 3′ cloning site NdeI (not destroyed)
- 5′ sequencing primer AGATCTCTTGGATCGGGCGCTGAAC
- 3′ sequencing primer CATATGATTTCTAGAGGCACAAGAC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PAM3 was a gift from Chantal Abergel (Addgene plasmid # 198742 ; http://n2t.net/addgene:198742 ; RRID:Addgene_198742) -
For your References section:
Genetic manipulation of giant viruses and their host, Acanthamoeba castellanii. Philippe N, Shukla A, Abergel C, Bisio H. Nat Protoc. 2023 Nov 14. doi: 10.1038/s41596-023-00910-y. 10.1038/s41596-023-00910-y PubMed 37964008