EF1α-Lox2272-LoxP-MARKS·mTurquoise2-NLS·turboRFP-Lox2272-LoxP
(Plasmid #198753)

• Purpose: Cre reporter, which switches from membraneous mTurquoise to nuclear RFP upon Cre recombinase activity
• Depositing Lab: Jacco van Rheenen
• Publication: Vizoso et al Nat Commun. 2022 Oct 28;13(1):6442. doi: 10.1038/s41467-022-33863-z.

Backbone

• Vector backbone: #37120 pAAV-EF1a-DO_DIO-TdTomato_EGFP-WPRE-pA
• Backbone manufacturer: K. Deisseroth Lab
• Backbone size w/o insert (bp): 5627
• Total vector size (bp): 11151
• Vector type: Mammalian Expression, Bacterial Expression, Lentiviral
• Selectable markers: Zeocin ; Bleomycin, Phleomycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: EF1a promotor-Lox2272-LoxP-MARKS-mTurquoise2-NLS.turboRFP-Lox2272-LOXP
• Alt name: membraneTq2 - NLS.turboRFP
• Species: Synthetic
• Insert Size (bp): 2893
• Mutation: See depositor comments below
• GenBank ID:
• Promoter: EF1a

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: AscI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: CTTCCATTTCAGGTGTCGTG
• 3′ sequencing primer: cgaggtcgacggtatcg

Resource Information

• A portion of this plasmid was derived from a plasmid made by: backbone:pAAV-Ef1a-DO_DIO-TdTomato_EGFP-WPRE-pA (Bernardo Sabatini), inserts: Rosa26 mT/mG (Liqun Luo), pK263.CAG-loxP-stop-loxP-NLSturboRFP-ires-tTA-WPRE (Takuji Iwasato). For more information, see comments

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Using pAAV-Ef1a-DO_DIO-TdTomato_EGFP-WPRE-pA (Bernardo Sabatini, #37120) as a backbone (cut AscI/NheI), we ligated the following fragments: first, we PCR the membrane bound sequence (MARKS, Rosa26 mT/mG (Liqun Luo), #17787), the mTurquoise2 sequence (+stop codon), and the nuclear NLS·turboRFP sequence (+stop codon) from pK263.CAG-loxP-stop-loxP-NLSturboRFP-ires-tTA-WPRE (Takuji Iwasato, #89587). MARKS was fused by PCR to mTurquoise2 using forward overlapping regions and NLS·turboRFP was fused to mTurquoise2 in a reversed orientation. The fusion product was ligated to the lentiviral backbone using the AscI-NheI restriction enzyme sites.

Please note: The plasmid contains AQ3-4CC mutations in MARCKS compared to the NCBI reference sequence AAH28284.1. These mutations are not expected to affect plasmid function.