UbC-blasticidine-P2A-TETon-3G transactivator
(Plasmid
#200191)
-
PurposeA TETon activator, which combined with the DiLiCre 2.0 plasmid, drives the expression of DiLiCre 2.0 upon doxycycline. DiLiCre 2.0 is a cre recombinase that is activated by violet light.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 200191 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbone#71666 pdCas9-DNMT3A-EGFP
-
Backbone manufacturerVlatka Zoldos
- Backbone size w/o insert (bp) 8020
- Total vector size (bp) 10400
-
Vector typeMammalian Expression, Bacterial Expression, Lentiviral
-
Selectable markersZeocin ; Bleomycin, Phleomycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameblasticidine - P2A - TETon-3G transactivator
-
SpeciesSynthetic
-
Insert Size (bp)2449
-
GenBank ID
- Promoter UbC
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer GAAGAGGTACACCAGCACCAAAG 3
- 3′ sequencing primer cgaggtcgacggtatcg (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byBackbone from pdCas9-DNMT3A-EGFP (Vlatka Zoldoš), P2A linker and a TETon3G fragment from pCAG-TetON-3G (Elena Cattaneo). For more information, see comments.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
A lentiviral UbC-blasticidine-P2A-TETon-3G transactivator vector was synthesized using the #71666 pdCas9-DNMT3A-EGFP vector backbone digested with NheI-EcoRI and ligated to the following DNA fragments: UbC promoter and blasticidine cassette amplified and fused by PCR using 40–50 bp internal overlapping primers and one external reverse primer containing a P2A linker, and a TETon-3G fragment amplified from the Addgene vector #96963 pCAG-TetON-3G using a forward primer containing a P2A sequence so it could be fused to the UbC-Blasticidin-P2A sequence during a last round PCR amplification with NheI and EcoRI external primers.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
UbC-blasticidine-P2A-TETon-3G transactivator was a gift from Jacco van Rheenen (Addgene plasmid # 200191 ; http://n2t.net/addgene:200191 ; RRID:Addgene_200191) -
For your References section:
A doxycycline- and light-inducible Cre recombinase mouse model for optogenetic genome editing. Vizoso M, E J Pritchard C, Bombardelli L, van den Broek B, Krimpenfort P, Beijersbergen RL, Jalink K, van Rheenen J. Nat Commun. 2022 Oct 28;13(1):6442. doi: 10.1038/s41467-022-33863-z. 10.1038/s41467-022-33863-z PubMed 36307419