Skip to main content

A3Bctd-L7G-Cas9n-UGI-NLS
(Plasmid #198886)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 198886 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    BE3
  • Backbone size w/o insert (bp) 9321
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Apolipoprotein B mRNA Editing Enzyme, Catalytic Polypeptide-like 3B C-terminal domain
  • Alt name
    APOBEC3B
  • Alt name
    A3B
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1472
  • Mutation
    Loop 7 of A3G
  • Entrez Gene
    APOBEC3B (a.k.a. A3B, APOBEC1L, ARCD3, ARP4, DJ742C19.2, PHRBNL, bK150C2.2)
  • Promoter CMV
  • Tag / Fusion Protein
    • NLS (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (not destroyed)
  • 3′ cloning site XmaI (not destroyed)
  • 5′ sequencing primer CGTGTACGGTGGGAGGTCTA
  • 3′ sequencing primer CAAAGAAGGAACCAGGTCCA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Also expresses Cas9n-UGI-NLS

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    A3Bctd-L7G-Cas9n-UGI-NLS was a gift from Reuben Harris (Addgene plasmid # 198886 ; http://n2t.net/addgene:198886 ; RRID:Addgene_198886)
  • For your References section:

    APOBEC Reporter Systems for Evaluating diNucleotide Editing Levels. Rieffer AE, Chen Y, Salamango DJ, Moraes SN, Harris RS. CRISPR J. 2023 Oct;6(5):430-446. doi: 10.1089/crispr.2023.0027. Epub 2023 Sep 6. 10.1089/crispr.2023.0027 PubMed 37672599