CSTI.pJL1
(Plasmid
#199113)
-
PurposeIn vitro expression of glycosyltransferase from Campylobacter jejuni for elaboration of sialic acid onto galactose in α2,3 linkage using CMP-sialic acid as substrate
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 199113 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepJL1
- Backbone size w/o insert (bp) 1763
- Total vector size (bp) 2681
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCSTI
-
SpeciesCampylobacter jejuni
-
Insert Size (bp)918
- Promoter T7
-
Tag
/ Fusion Protein
- CAT linker, Strep-tag (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (not destroyed)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer TAGTTATTGCTCAGCGGTGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CSTI.pJL1 was a gift from Michael Jewett (Addgene plasmid # 199113 ; http://n2t.net/addgene:199113 ; RRID:Addgene_199113) -
For your References section:
GlycoCAP: A Cell-Free, Bacterial Glycosylation Platform for Building Clickable Azido-Sialoglycoproteins. Thames AH, Moons SJ, Wong DA, Boltje TJ, Bochner BS, Jewett MC. ACS Synth Biol. 2023 Apr 11. doi: 10.1021/acssynbio.3c00017. 10.1021/acssynbio.3c00017 PubMed 37040463