Skip to main content

NeuA.pJL1
(Plasmid #199115)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 199115 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pJL1
  • Backbone size w/o insert (bp) 1763
  • Total vector size (bp) 3050
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    N-acylneuraminate cytodiylyltransfease (NeuA)
  • Alt name
    CMP-sialic acid synthase
  • Species
    Escherichia coli
  • Insert Size (bp)
    1287
  • Promoter T7
  • Tag / Fusion Protein
    • Strep-tag (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer TAGTTATTGCTCAGCGGTGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    NeuA.pJL1 was a gift from Michael Jewett (Addgene plasmid # 199115 ; http://n2t.net/addgene:199115 ; RRID:Addgene_199115)
  • For your References section:

    GlycoCAP: A Cell-Free, Bacterial Glycosylation Platform for Building Clickable Azido-Sialoglycoproteins. Thames AH, Moons SJ, Wong DA, Boltje TJ, Bochner BS, Jewett MC. ACS Synth Biol. 2023 Apr 11. doi: 10.1021/acssynbio.3c00017. 10.1021/acssynbio.3c00017 PubMed 37040463