pDS170-enNTS1
(Plasmid
#199152)
-
PurposeJZ73, bacterial expression construct expressing thermostabilised rat neurotensin receptor 1 (enNTS1)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 199152 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepDS170
-
Backbone manufacturerInternal Lab Plasmid
- Backbone size w/o insert (bp) 6112
- Total vector size (bp) 7234
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameenNTS1
-
Alt nameThermostabilised rat neurotensin receptor 1
-
SpeciesR. norvegicus (rat)
-
Insert Size (bp)1122
-
MutationV208M, C273S, C391S and C393S (over NTS1-B5)
-
Entrez GeneNtsr1 (a.k.a. Ntsr)
- Promoter Lac/T5
-
Tags
/ Fusion Proteins
- MBP (N terminal on backbone)
- muGFP (C terminal on backbone)
- 10xHis tag (N terminal on backbone)
- Avi tag (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site NheI (not destroyed)
- 5′ sequencing primer CTGAAAGACGCGCAGAC
- 3′ sequencing primer ATCCATGCCATGTGTAATCCCAG
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
For additional information, please refer to:
Bumbak et al. 2018 "Optimization and 13CH3 methionine labeling of a signaling competent neurotensin receptor 1 variant for NMR studies" BBA Biomembranes. https://doi.org/10.1016/j.bbamem.2018.03.020
Bumbak et al. 2019 "Expression and Purification of a Functional E. coli 13CH3-Methionine-Labeled Thermostable Neurotensin Receptor 1 Variant for Solution NMR Studies" Methods Mol Biol. https://doi.org/10.1007/978-1-4939-9121-1_3
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDS170-enNTS1 was a gift from Daniel Scott (Addgene plasmid # 199152 ; http://n2t.net/addgene:199152 ; RRID:Addgene_199152) -
For your References section:
Ligands selectively tune the local and global motions of neurotensin receptor 1 (NTS(1)). Bumbak F, Pons M, Inoue A, Paniagua JC, Yan F, Wu H, Robson SA, Bathgate RAD, Scott DJ, Gooley PR, Ziarek JJ. Cell Rep. 2023 Jan 31;42(1):112015. doi: 10.1016/j.celrep.2023.112015. Epub 2023 Jan 20. 10.1016/j.celrep.2023.112015 PubMed 36680775