pDS170-enNTS1
(Plasmid #199152)

• Purpose: JZ73, bacterial expression construct expressing thermostabilised rat neurotensin receptor 1 (enNTS1)
• Depositing Lab: Daniel Scott
• Publication: Bumbak et al Cell Rep. 2023 Jan 31;42(1):112015. doi: 10.1016/j.celrep.2023.112015. Epub 2023 Jan 20.

Backbone

• Vector backbone: pDS170
• Backbone manufacturer: Internal Lab Plasmid
• Backbone size w/o insert (bp): 6112
• Total vector size (bp): 7234
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: enNTS1
• Alt name: Thermostabilised rat neurotensin receptor 1
• Species: R. norvegicus (rat)
• Insert Size (bp): 1122
• Mutation: V208M, C273S, C391S and C393S (over NTS1-B5)
• Entrez Gene: Ntsr1 (a.k.a. Ntsr)
• Promoter: Lac/T5
• Tags / Fusion Proteins:
  • MBP (N terminal on backbone)
  • muGFP (C terminal on backbone)
  • 10xHis tag (N terminal on backbone)
  • Avi tag (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: NheI (not destroyed)
• 5′ sequencing primer: CTGAAAGACGCGCAGAC
• 3′ sequencing primer: ATCCATGCCATGTGTAATCCCAG

Resource Information

• Supplemental Documents:
  • pds170-ennts1.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

For additional information, please refer to:
Bumbak et al. 2018 "Optimization and 13CH3 methionine labeling of a signaling competent neurotensin receptor 1 variant for NMR studies" BBA Biomembranes. https://doi.org/10.1016/j.bbamem.2018.03.020
Bumbak et al. 2019 "Expression and Purification of a Functional E. coli 13CH3-Methionine-Labeled Thermostable Neurotensin Receptor 1 Variant for Solution NMR Studies" Methods Mol Biol. https://doi.org/10.1007/978-1-4939-9121-1_3