pEGFP-C3-Rabaptin-5
(Plasmid
#199173)
-
PurposeExpresses GFP-Rabaptin-5 fusion in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 199173 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepEGFP-C3
- Backbone size w/o insert (bp) 4727
- Total vector size (bp) 7452
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameRabaptin-5
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2726
-
MutationContains Tyr 149 Ser substitution; insert starts at codon 6 (encodes human Rabaptin-5 (6-862))
-
Entrez GeneRABEP1 (a.k.a. RAB5EP, RABPT5)
- Promoter CMV
-
Tag
/ Fusion Protein
- EGFP (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SmaI (destroyed during cloning)
- 3′ cloning site SmaI (destroyed during cloning)
- 5′ sequencing primer pEGFP-C forward: 5’ CATGGTCCTGCTGGAGTTCGTG
- 3′ sequencing primer pEGFP-C reverse: 5’ GCTTTATTTGTGAAATTTGTGATGC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
ApaI/NotI Rabaptin-5 insert was polished with T7 DNA polymerase and subcloned into SmaI site of pEGFP-C3 vector. Insert contains ~140 bp of 3' UTR after stop codon.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEGFP-C3-Rabaptin-5 was a gift from Juan Bonifacino (Addgene plasmid # 199173 ; http://n2t.net/addgene:199173 ; RRID:Addgene_199173) -
For your References section:
Divalent interaction of the GGAs with the Rabaptin-5-Rabex-5 complex. Mattera R, Arighi CN, Lodge R, Zerial M, Bonifacino JS. EMBO J. 2003 Jan 2;22(1):78-88. doi: 10.1093/emboj/cdg015. 10.1093/emboj/cdg015 PubMed 12505986