pUC18T-mini-Tn7T-Gm-Pc-sfGFP
(Plasmid
#199248)
-
PurposeFluorescent labelling of bacterial cells with sfGFP
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 199248 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepUC18R6K-mini-Tn7T-Gm and pUC18T-mini-Tn7T
- Backbone size w/o insert (bp) 4521
- Total vector size (bp) 4780
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCodon-optimized sfGFP gene
-
SpeciesSynthetic
-
Insert Size (bp)717
-
MutationCodon optimization for Xanthomonadaceae
-
GenBank IDWAK86295.1
- Promoter Pc promoter from class III integron of Delftia acidovorans C17, synthetic
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site SacI (not destroyed)
- 5′ sequencing primer TACGAACCGAACAGGCTTATGTC
- 3′ sequencing primer GTTGGCCGATTCATTAATGCAGC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made bySynthetic codon-optimized gene
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pUC18T-mini-Tn7T-Gm-Pc-sfGFP was a gift from Uwe Mamat (Addgene plasmid # 199248 ; http://n2t.net/addgene:199248 ; RRID:Addgene_199248) -
For your References section:
Improved mini-Tn7 Delivery Plasmids for Fluorescent Labeling of Stenotrophomonas maltophilia. Mamat U, Hein M, Grella D, Taylor CS, Scholzen T, Alio I, Streit WR, Huedo P, Coves X, Conchillo-Sole O, Gomez AC, Gibert I, Yero D, Schaible UE. Appl Environ Microbiol. 2023 May 17:e0031723. doi: 10.1128/aem.00317-23. 10.1128/aem.00317-23 PubMed 37195181