Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pUC18T-mini-Tn7T-Gm-Pc-sfGFP
(Plasmid #199248)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 199248 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pUC18R6K-mini-Tn7T-Gm and pUC18T-mini-Tn7T
  • Backbone size w/o insert (bp) 4521
  • Total vector size (bp) 4780
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Codon-optimized sfGFP gene
  • Species
    Synthetic
  • Insert Size (bp)
    717
  • Mutation
    Codon optimization for Xanthomonadaceae
  • GenBank ID
    WAK86295.1
  • Promoter Pc promoter from class III integron of Delftia acidovorans C17, synthetic

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site SacI (not destroyed)
  • 5′ sequencing primer TACGAACCGAACAGGCTTATGTC
  • 3′ sequencing primer GTTGGCCGATTCATTAATGCAGC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pUC18T-mini-Tn7T-Gm-Pc-sfGFP was a gift from Uwe Mamat (Addgene plasmid # 199248 ; http://n2t.net/addgene:199248 ; RRID:Addgene_199248)
  • For your References section:

    Improved mini-Tn7 Delivery Plasmids for Fluorescent Labeling of Stenotrophomonas maltophilia. Mamat U, Hein M, Grella D, Taylor CS, Scholzen T, Alio I, Streit WR, Huedo P, Coves X, Conchillo-Sole O, Gomez AC, Gibert I, Yero D, Schaible UE. Appl Environ Microbiol. 2023 May 17:e0031723. doi: 10.1128/aem.00317-23. 10.1128/aem.00317-23 PubMed 37195181