Lsg-GBA-1 + 2
(Plasmid
#199276)
-
Purposenicking sgRNA to induce or correct GBA (c. 1226 A > G) mutation using PE3
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 199276 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepU6
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGBA nick
-
gRNA/shRNA sequenceACCCTTACCTACACTCTCTG
-
SpeciesSynthetic
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer LKO.1 5' (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byThe backbone is from Addgene Plasmid #47108.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Lsg-GBA-1 + 2 was a gift from Ting Zhou (Addgene plasmid # 199276 ; http://n2t.net/addgene:199276 ; RRID:Addgene_199276) -
For your References section:
Transient inhibition of p53 enhances prime editing and cytosine base-editing efficiencies in human pluripotent stem cells. Li M, Zhong A, Wu Y, Sidharta M, Beaury M, Zhao X, Studer L, Zhou T. Nat Commun. 2022 Oct 27;13(1):6354. doi: 10.1038/s41467-022-34045-7. 10.1038/s41467-022-34045-7 PubMed 36302757