pAKgfplux3
(Plasmid
#199304)
-
PurposeFluorescence and bioluminescence expression in Gram-negative bacteria
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 199304 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepAKgfplux1
-
Backbone manufacturerKarsilab
- Backbone size w/o insert (bp) 11547
- Total vector size (bp) 12240
-
Modifications to backboneA 717 bp fragment containing chloramphenicol resistance gene was amplified from pMJH46 and inserted into broad host range plasmid pAKgfplux1.
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameChloramphenicol acetyltransferase
-
Alt namecat
-
Insert Size (bp)717
-
GenBank ID
- Promoter T7
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site sacI (not destroyed)
- 3′ cloning site speI (not destroyed)
- 5′ sequencing primer TCGAGATTTTCAGGAGCTAAGG
- 3′ sequencing primer AGGGCACCAATAACTGCCTTA
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAKgfplux3 was a gift from Attila Karsi (Addgene plasmid # 199304 ; http://n2t.net/addgene:199304 ; RRID:Addgene_199304) -
For your References section:
Development of Bioluminescent Virulent Aeromonas hydrophila for Understanding Pathogenicity. Ozdemir E, Abdelhamed H, Ozdemir O, Lawrence M, Karsi A. Pathogens. 2023 May 2;12(5):670. doi: 10.3390/pathogens12050670. 10.3390/pathogens12050670 PubMed 37242340