Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pHR-iCasp9
(Plasmid #199441)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 199441 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pHR-mCherry
  • Backbone size w/o insert (bp) 9976
  • Total vector size (bp) 11242
  • Vector type
    Mammalian Expression, Bacterial Expression, Lentiviral
  • Selectable markers
    mCherry Fluorescence

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    inducible Caspase9
  • Species
    H. sapiens (human)
  • Entrez Gene
    CASP9 (a.k.a. APAF-3, APAF3, ICE-LAP6, MCH6, PPP1R56)
  • Tags / Fusion Proteins
    • mCherry
    • DmrB (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SpeI (unknown if destroyed)
  • 3′ cloning site BamHI (unknown if destroyed)
  • 5′ sequencing primer ATGGCTTCTAGAGGAGTGCA
  • 3′ sequencing primer CGCGGATCCCGCTGATGTTTTAAAGAAAA
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note: Plasmid contains a S113R mutation in the DmrB-iCasp9-mCherry insert. This mutation is not known to affect plasmid function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHR-iCasp9 was a gift from Chao Tang (Addgene plasmid # 199441 ; http://n2t.net/addgene:199441 ; RRID:Addgene_199441)
  • For your References section:

    Cell-to-cell variability in inducible Caspase9-mediated cell death. Yuan Y, Ren H, Li Y, Qin S, Yang X, Tang C. Cell Death Dis. 2022 Jan 10;13(1):34. doi: 10.1038/s41419-021-04468-z. 10.1038/s41419-021-04468-z PubMed 35013114