pSA_1_mTagBFP2_synCoTC
(Plasmid
#199473)
-
PurposeSite directed zebrafish mutagenesis. sgRNA GAAGATCGGCCACTACATTC
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 199473 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepUC57
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemTagBFP2
-
SpeciesSynthetic
Cloning Information
- Cloning method Unknown
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSA_1_mTagBFP2_synCoTC was a gift from Robert Bryson-Richardson (Addgene plasmid # 199473 ; http://n2t.net/addgene:199473 ; RRID:Addgene_199473) -
For your References section:
CRIMP: A CRISPR/Cas9 Insertional Mutagenesis Protocol and the CRIMP Toolkit. Miles LB, Calcinotto V, Sonntag C, Lee C, Bryson-Richardson RJ. bioRxiv 2023 10.1101/2023.07.13.548929