pPfetFn-Target_v2
(Plasmid
#199564)
-
PurposegRNA expression for FnCas12a in E. coli and clostridia
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 199564 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepGG2121
- Backbone size w/o insert (bp) 1500
- Total vector size (bp) 6365
-
Modifications to backboneBased on pMTL82121, change teminator TCD0164 to TtyrS and add BsaI Golden-Gate sites
-
Vector typeBacterial Expression, CRISPR, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameSacB
-
gRNA/shRNA sequenceAATTTCTACTGTTGTAGATtGAGACGattCGTCTCcAATTTCTACTGTTGTAGAT
-
SpeciesBacillus subtilis
-
GenBank ID936413
- Promoter Pthl_fU
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site PvuI (not destroyed)
- 3′ cloning site PstI (not destroyed)
- 5′ sequencing primer GCcgatcgTTTTTAACAAAATATATTGATAAAAATAATAATAGTGGGT
- 3′ sequencing primer cgctgcagttatttgttaactgttaattgtccttg
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pPfetFn-Target_v2 was a gift from Philippe Lambin (Addgene plasmid # 199564 ; http://n2t.net/addgene:199564 ; RRID:Addgene_199564) -
For your References section:
Development of a CRISPR-Cas12a system for efficient genome engineering in clostridia. Zhang Y, Kubiak AM, Bailey TS, Claessen L, Hittmeyer P, Dubois L, Theys J, Lambin P. Microbiol Spectr. 2023 Nov 10:e0245923. doi: 10.1128/spectrum.02459-23. 10.1128/spectrum.02459-23 PubMed 37947521