pX330_EZH2gRNA16
(Plasmid
#199588)
-
PurposeContains guide RNA to 3' end of mouse EZH2 gene
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 199588 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepX330 (Addgene#42230)
-
Backbone manufacturerAddgene #42230
- Backbone size w/o insert (bp) 8488
- Total vector size (bp) 8508
-
Vector typeMammalian Expression, Bacterial Expression, Mouse Targeting, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameEZH2
-
gRNA/shRNA sequencetgaccagtcactatttgctg
-
SpeciesM. musculus (mouse)
-
Entrez GeneEzh2 (a.k.a. Enx-1, Enx1h, KMT6, mKIAA4065)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (destroyed during cloning)
- 3′ cloning site BbsI (destroyed during cloning)
- 5′ sequencing primer ACTATCATATGCTTACCGTAAC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pX330_EZH2gRNA16 was a gift from Mauro Calabrese (Addgene plasmid # 199588 ; http://n2t.net/addgene:199588 ; RRID:Addgene_199588) -
For your References section:
A monoclonal antibody raised against human EZH2 cross-reacts with the RNA-binding protein SAFB. Cherney RE, Mills CA, Herring LE, Braceros AK, Calabrese JM. bioRxiv. 2023 Apr 3:2023.04.03.535391. doi: 10.1101/2023.04.03.535391. Preprint. 10.1101/2023.04.03.535391 PubMed 37066147