Skip to main content

pX330_EZH2gRNA17
(Plasmid #199589)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 199589 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pX330 (Addgene#42230)
  • Backbone manufacturer
    Addgene #42230
  • Backbone size w/o insert (bp) 8488
  • Total vector size (bp) 8508
  • Vector type
    Mammalian Expression, Bacterial Expression, Mouse Targeting, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    EZH2
  • gRNA/shRNA sequence
    tacgcatagattaagcccca
  • Species
    M. musculus (mouse)
  • Entrez Gene
    Ezh2 (a.k.a. Enx-1, Enx1h, KMT6, mKIAA4065)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (destroyed during cloning)
  • 3′ cloning site BbsI (destroyed during cloning)
  • 5′ sequencing primer actatcatatgcttaccgtaac
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pX330_EZH2gRNA17 was a gift from Mauro Calabrese (Addgene plasmid # 199589 ; http://n2t.net/addgene:199589 ; RRID:Addgene_199589)
  • For your References section:

    A monoclonal antibody raised against human EZH2 cross-reacts with the RNA-binding protein SAFB. Cherney RE, Mills CA, Herring LE, Braceros AK, Calabrese JM. bioRxiv. 2023 Apr 3:2023.04.03.535391. doi: 10.1101/2023.04.03.535391. Preprint. 10.1101/2023.04.03.535391 PubMed 37066147