pCambia-loxKan
(Plasmid
#199590)
-
Purposebasic plant vector with a plant-selectable kanamycin resistance cassette flanked by both loxP and FRT sites for sustainable plant engineering with subsequent marker removal possibility
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 199590 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 * | |
* Log in to view industry pricing.
Backbone
-
Vector backbonepCambia1302
-
Backbone manufacturerCambia Foundation
- Backbone size w/o insert (bp) 8620
- Total vector size (bp) 10184
-
Vector typePlant Expression, Cre/Lox
-
Selectable markersKanamycin
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth TemperatureRoom Temperature
-
Growth Strain(s)DH5alpha
-
Growth instructionsCan grow in E.coli (high copy) but also in Agrobacterium (low copy), as normal pCambia vectors. Selection is kanamycin containing LB in E. coli and Agrobacterium
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameFRT-lox66-NosP-KanR-NosT-lox71-FRT
-
Alt nameremovable kanamycin resistance cassette
-
SpeciesSynthetic
-
Insert Size (bp)1564
- Promoter Nos
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer ctagagcagcttgccaacatgg
- 3′ sequencing primer ctagaattcgagctcagcgttcc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made bysynthetic DNA
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCambia-loxKan was a gift from Andreas Stuermer (Addgene plasmid # 199590 ; http://n2t.net/addgene:199590 ; RRID:Addgene_199590)