Skip to main content

LentiCas9-sgVRK1 #1-Blast
(Plasmid #199646)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 199646 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    lentiCas9-Blast
  • Vector type
    Lentiviral
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    N/A
  • gRNA/shRNA sequence
    CCCAATACTTAGGAACACCC
  • Species
    H. sapiens (human)
  • Entrez Gene
    VRK1 (a.k.a. PCH1, PCH1A)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    LentiCas9-sgVRK1 #1-Blast was a gift from William Hahn (Addgene plasmid # 199646 ; http://n2t.net/addgene:199646 ; RRID:Addgene_199646)
  • For your References section:

    VRK1 as a synthetic lethal target in VRK2 promoter-methylated cancers of the nervous system. So J, Mabe NW, Englinger B, Chow KH, Moyer SM, Yerrum S, Trissal MC, Marques JG, Kwon JJ, Shim B, Pal S, Panditharatna E, Quinn T, Schaefer DA, Jeong D, Mayhew DL, Hwang J, Beroukhim R, Ligon KL, Stegmaier K, Filbin MG, Hahn WC. JCI Insight. 2022 Oct 10;7(19):e158755. doi: 10.1172/jci.insight.158755. 10.1172/jci.insight.158755 PubMed 36040810