pcDNA3.1(-)-Green Falcan10
(Plasmid
#199707)
-
Purposegreen fluorescent indicator for cAMP imaging
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 199707 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepcDNA3.1(-)
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGreen Falcan10
-
Insert Size (bp)1521
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3.1(-)-Green Falcan10 was a gift from Tetsuya Kitaguchi (Addgene plasmid # 199707 ; http://n2t.net/addgene:199707 ; RRID:Addgene_199707) -
For your References section:
Development of green fluorescent protein-based cAMP indicators for covering a wide range of cAMP concentrations. Hiasa S, Fujimori T, Aiki S, Ueda H, Tsuboi T, Kitaguchi T. RSC Adv. 2023 May 22;13(23):15514-15520. doi: 10.1039/d3ra01390a. eCollection 2023 May 22. 10.1039/d3ra01390a PubMed 37223420