Skip to main content

tracrRNA(scr)-CJ8421_04975 mRNA
(Plasmid #199718)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 199718 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCSM180
  • Backbone size w/o insert (bp) 2116
  • Total vector size (bp) 3488
  • Modifications to backbone
    Inserts CJ8421_04975 mRNA and scrambled tracrRNA
  • Vector type
    Bacterial Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    One Shot™ TOP10
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CJ8421_04975 mRNA and scrambled tracrRNA
  • Species
    Campylobacter jejuni
  • Insert Size (bp)
    1372

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer tcgggtttcgccacctctgact
  • 3′ sequencing primer tcgctgagataggtgcctcac
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    tracrRNA(scr)-CJ8421_04975 mRNA was a gift from Chase Beisel (Addgene plasmid # 199718 ; http://n2t.net/addgene:199718 ; RRID:Addgene_199718)
  • For your References section:

    RNA recording in single bacterial cells using reprogrammed tracrRNAs. Jiao C, Reckstadt C, Konig F, Homberger C, Yu J, Vogel J, Westermann AJ, Sharma CM, Beisel CL. Nat Biotechnol. 2023 Jan 5. doi: 10.1038/s41587-022-01604-8. 10.1038/s41587-022-01604-8 PubMed 36604543