pITR-AAV-Rep2Cap9-GFP
(Plasmid
#199744)
-
PurposeExpresses AAV2 Rep and AAV9 Cap, with GFP replacing a region of Cap, within AAV2 ITRs.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 199744 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $32 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonepSub201
-
Backbone manufacturerThe National Gene Vector Biorepository
- Backbone size w/o insert (bp) 5965
- Total vector size (bp) 7747
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAAV9 Cap w/ GFP insert
-
SpeciesSynthetic
-
Insert Size (bp)1785
-
MutationReplaced amino acids 356-736 in Cap with GFP
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer ATCATGGGAAAGGTGCCAGAC
- 3′ sequencing primer GTACAGCTCGTCCATGCCGA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pITR-AAV-Rep2Cap9-GFP was a gift from Aravind Asokan (Addgene plasmid # 199744 ; http://n2t.net/addgene:199744 ; RRID:Addgene_199744) -
For your References section:
Structure-guided AAV capsid evolution strategies for enhanced CNS gene delivery. Gonzalez TJ, Mitchell-Dick A, Blondel LO, Fanous MM, Hull JA, Oh DK, Moller-Tank S, Castellanos Rivera RM, Piedrahita JA, Asokan A. Nat Protoc. 2023 Sep 21. doi: 10.1038/s41596-023-00875-y. 10.1038/s41596-023-00875-y PubMed 37735235