pLJM1-Lamp1 FLAG
(Plasmid
#199750)
-
PurposeLentiviral construct to stably express Lamp1
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 199750 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepLJM1
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLamp1
-
SpeciesR. norvegicus (rat)
-
Entrez GeneLamp1 (a.k.a. LGP120)
- Promoter EF1a
-
Tag
/ Fusion Protein
- Flag (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer TCAAGCCTCAGACAGTGGTTC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLJM1-Lamp1 FLAG was a gift from Roberto Zoncu (Addgene plasmid # 199750 ; http://n2t.net/addgene:199750 ; RRID:Addgene_199750) -
For your References section:
Lysosomal GPCR-like protein LYCHOS signals cholesterol sufficiency to mTORC1. Shin HR, Citron YR, Wang L, Tribouillard L, Goul CS, Stipp R, Sugasawa Y, Jain A, Samson N, Lim CY, Davis OB, Castaneda-Carpio D, Qian M, Nomura DK, Perera RM, Park E, Covey DF, Laplante M, Evers AS, Zoncu R. Science. 2022 Sep 16;377(6612):1290-1298. doi: 10.1126/science.abg6621. Epub 2022 Aug 25. 10.1126/science.abg6621 PubMed 36007018