pGEX-4T1-GST-Thrombin-TEV-EGFP-hNEMO
              
              
                (Plasmid
                
                #199781)
              
            
            
            
          - 
            PurposePlasmid for the expression of GFP labelled NEMO (SMC Internal No. 1977).
 - 
              Depositing Lab
 - 
          Publication
 - 
          Sequence Information
 
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 199781 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backbonepGEX-4T1
 - Backbone size w/o insert (bp) 5710
 - Total vector size (bp) 6967
 - 
              Vector typeBacterial Expression
 
Growth in Bacteria
- 
            Bacterial Resistance(s)Ampicillin, 100 μg/mL
 - 
            Growth Temperature37°C
 - 
            Growth Strain(s)DH5alpha
 - 
            Copy numberUnknown
 
Gene/Insert
- 
                Gene/Insert nameNEMO
 - 
                  Alt nameIKBKG
 - 
                    SpeciesH. sapiens (human)
 - 
                  Insert Size (bp)1257
 - 
                    GenBank IDAF062089.1
 - 
                        Entrez GeneIKBKG (a.k.a. AMCBX1, EDAID1, FIP-3, FIP3, Fip3p, IKK-gamma, IKKAP1, IKKG, IMD33, IP, IP1, IP2, IPD2, NEMO, SAIDX, ZC2HC9)
 - 
    
        Tag
        / Fusion Protein
    
- GST-Thrombin-TEV-EGFP (N terminal on insert)
 
 
Cloning Information
- Cloning method Restriction Enzyme
 - 5′ cloning site BamHI (not destroyed)
 - 3′ cloning site Not1 (not destroyed)
 - 5′ sequencing primer aataggcacctctggaagagccaactgtgt
 - 3′ sequencing primer ctactcaatgcactccatgacatgtatctg (Common Sequencing Primers)
 
Resource Information
- 
            
            
            Supplemental Documents
 
Terms and Licenses
- 
        Academic/Nonprofit Terms
 - 
      Industry Terms
- Not Available to Industry
 
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
 
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              
For your Materials & Methods section:
pGEX-4T1-GST-Thrombin-TEV-EGFP-hNEMO was a gift from Sascha Martens (Addgene plasmid # 199781 ; http://n2t.net/addgene:199781 ; RRID:Addgene_199781)