mtsCOXVIIIx2-B-gTEMP/pcDNA3
(Plasmid
#199806)
-
PurposeFluorescent temperature indicator B-gTEMP fused with mitochondrial targeting sequence
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 199806 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcDNA3
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameB-gTEMP
-
SpeciesSynthetic
-
Tag
/ Fusion Protein
- mtsCOXVIIIx2 (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (unknown if destroyed)
- 3′ cloning site XhoI (unknown if destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer CATTTAGGTGACACTATAG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
mtsCOXVIIIx2-B-gTEMP/pcDNA3 was a gift from Takeharu Nagai (Addgene plasmid # 199806 ; http://n2t.net/addgene:199806 ; RRID:Addgene_199806) -
For your References section:
Intracellular Heat Transfer and Thermal Property Revealed by Kilohertz Temperature Imaging with a Genetically Encoded Nanothermometer. Lu K, Wazawa T, Sakamoto J, Vu CQ, Nakano M, Kamei Y, Nagai T. Nano Lett. 2022 Jul 27;22(14):5698-5707. doi: 10.1021/acs.nanolett.2c00608. Epub 2022 Jul 6. 10.1021/acs.nanolett.2c00608 PubMed 35792763