Skip to main content

mtsCOXVIIIx2-B-gTEMP/pcDNA3
(Plasmid #199806)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 199806 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pcDNA3
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    B-gTEMP
  • Species
    Synthetic
  • Tag / Fusion Protein
    • mtsCOXVIIIx2 (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (unknown if destroyed)
  • 3′ cloning site XhoI (unknown if destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer CATTTAGGTGACACTATAG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    mtsCOXVIIIx2-B-gTEMP/pcDNA3 was a gift from Takeharu Nagai (Addgene plasmid # 199806 ; http://n2t.net/addgene:199806 ; RRID:Addgene_199806)
  • For your References section:

    Intracellular Heat Transfer and Thermal Property Revealed by Kilohertz Temperature Imaging with a Genetically Encoded Nanothermometer. Lu K, Wazawa T, Sakamoto J, Vu CQ, Nakano M, Kamei Y, Nagai T. Nano Lett. 2022 Jul 27;22(14):5698-5707. doi: 10.1021/acs.nanolett.2c00608. Epub 2022 Jul 6. 10.1021/acs.nanolett.2c00608 PubMed 35792763