pAureus-TnCAM
(Plasmid #199807)

• Purpose: vector for transposome-mediated saturation mutagenesis and Tn-Seq in S. aureus
• Depositing Lab: Steve Salipante
• Publication: Lo et al Infect Immun. 2023 Oct 17;91(10):e0022823. doi: 10.1128/iai.00228-23. Epub 2023 Sep 7.

Backbone

• Vector backbone: puc19
• Backbone size w/o insert (bp): 2686
• Total vector size (bp): 3806
• Modifications to backbone: Addition of a synthetic transposon cassette enabling transposome-mediated saturation mutagenesis in S. aureus. The transposon cassette is flanked by mosaic end sequences recognized by Tn5 transposase, and contains a cat194 chloramphenicol resistance gene driven by the constitutive sarA promoter and sodB ribosome binding site. A bidirectional blaZ transcriptional terminator downstream of the resistance cassette limits polar effects from read-through transcription of adjacent genes and interference of resistance gene expression from opposing transcripts in the bacterial genome.
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol, 25 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: transposon cassette
• Species: S. aureus
• Insert Size (bp): 1120

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: KasI (not destroyed)
• 3′ cloning site: HindIII (not destroyed)
• 5′ sequencing primer: AGGCCTAATGACTGGCTTTT
• 3′ sequencing primer: TGGCTAGTGCGTAGTCGTTG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

See source publication for detailed protocols describing this vector's use.