QUAS-jGCaMP7s-T2A-tdTomato
(Plasmid #200010)

• Purpose: QUAS reporter line expressing GCaMP7s calcium indicator and tdTomato, separated by T2A
• Depositing Lab: Carolyn McBride
• Publication: Zhao et al Nature. 2022 May;605(7911):706-712. doi: 10.1038/s41586-022-04675-4. Epub 2022 May 4.

Backbone

• Vector backbone: ampilfied from 15xQUAS-Syt1-tdTomato-3XP3-ECFP
• Backbone size w/o insert (bp): 3377
• Total vector size (bp): 9523
• Vector type: Insect Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: 3xP3-ECFP-jGCaMP7s-td-Tomato
• Insert Size (bp): 4809

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

We used pBac-mediated transposition according to a previously published method to generate a QUAS-jGCaMP7s-T2A-tdTomato effector strain that could be used in concert with a pan-neuronal driver to image from all glomeruli. We generated the template for in vitro transcription of pBac mRNA via PCR amplification from a plasmid containing the pBac coding sequence (a gift from Leslie Vosshall; primers forward 5’- GAAACTAATACGACTCACTATAGGGAGAGCCGCCACATGGGTAGTTCTTTAGACGATG
-3’, reverse 5’- CTTATTAGTCAGTCAGAAACAAC -3’). The PCR amplicon was purified using RNAse-free SPRI beads (Agencourt RNAclean XP, Beckman-Coulter A63987) and then used for in vitro transcription with the HiScribe T7 ARCA mRNA Kit (with tailing, NEB, E2060S). Transcription products were purified using RNAse-free SPRI beads, and eluted in Ambion nuclease-free water (Life Technologies, AM9937). The transgene plasmid was generated using the InFusion HD Kit (Clontech, 638910) and the NucleoBond Xtra Midi EF Kit (Macherey-Nagel, 740420.10). jGCaMP7s was cloned from a Drosophila melanogaster fly that contained the jGCaMP7s transgene (a gift from Mala Murthy; primers forward 5’- CGCGGCTCGAGCAAAATGGGCTCACATCATCACCA -3’, reverse 5’- GGCCCTCTCCCGATCCTTTGGCGGTCATCATTTGTACG -3’).