pAAV9-null
(Plasmid
#200182)
-
PurposeExpresses AAV2 Rep and AAV9 Cap with nonsense mutation at VR8 site
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 200182 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepMCV
- Backbone size w/o insert (bp) 1799
- Total vector size (bp) 6087
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAAV9 Cap w/ nonsense mutation at VR8
-
SpeciesSynthetic
-
Insert Size (bp)2210
-
MutationReplaced amino acids 586-592 in Cap with nonsense mutation
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer TCATGGGAAAGGTGCCAGAC
- 3′ sequencing primer cctctgacttgagcgtcgattt (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV9-null was a gift from Aravind Asokan (Addgene plasmid # 200182 ; http://n2t.net/addgene:200182 ; RRID:Addgene_200182) -
For your References section:
Structure-guided AAV capsid evolution strategies for enhanced CNS gene delivery. Gonzalez TJ, Mitchell-Dick A, Blondel LO, Fanous MM, Hull JA, Oh DK, Moller-Tank S, Castellanos Rivera RM, Piedrahita JA, Asokan A. Nat Protoc. 2023 Sep 21. doi: 10.1038/s41596-023-00875-y. 10.1038/s41596-023-00875-y PubMed 37735235