Skip to main content

UbC-blasticidine-P2A-TETon-3G transactivator
(Plasmid #200191)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 200191 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    #71666 pdCas9-DNMT3A-EGFP
  • Backbone manufacturer
    Vlatka Zoldos
  • Backbone size w/o insert (bp) 8020
  • Total vector size (bp) 10400
  • Vector type
    Mammalian Expression, Bacterial Expression, Lentiviral
  • Selectable markers
    Zeocin ; Bleomycin, Phleomycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    blasticidine - P2A - TETon-3G transactivator
  • Species
    Synthetic
  • Insert Size (bp)
    2449
  • GenBank ID
  • Promoter UbC

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer GAAGAGGTACACCAGCACCAAAG 3
  • 3′ sequencing primer cgaggtcgacggtatcg
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Backbone from pdCas9-DNMT3A-EGFP (Vlatka Zoldoš), P2A linker and a TETon3G fragment from pCAG-TetON-3G (Elena Cattaneo). For more information, see comments.

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

A lentiviral UbC-blasticidine-P2A-TETon-3G transactivator vector was synthesized using the #71666 pdCas9-DNMT3A-EGFP vector backbone digested with NheI-EcoRI and ligated to the following DNA fragments: UbC promoter and blasticidine cassette amplified and fused by PCR using 40–50 bp internal overlapping primers and one external reverse primer containing a P2A linker, and a TETon-3G fragment amplified from the Addgene vector #96963 pCAG-TetON-3G using a forward primer containing a P2A sequence so it could be fused to the UbC-Blasticidin-P2A sequence during a last round PCR amplification with NheI and EcoRI external primers.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    UbC-blasticidine-P2A-TETon-3G transactivator was a gift from Jacco van Rheenen (Addgene plasmid # 200191 ; http://n2t.net/addgene:200191 ; RRID:Addgene_200191)
  • For your References section:

    A doxycycline- and light-inducible Cre recombinase mouse model for optogenetic genome editing. Vizoso M, E J Pritchard C, Bombardelli L, van den Broek B, Krimpenfort P, Beijersbergen RL, Jalink K, van Rheenen J. Nat Commun. 2022 Oct 28;13(1):6442. doi: 10.1038/s41467-022-33863-z. 10.1038/s41467-022-33863-z PubMed 36307419