mAMCase_CatD_6xHis_pTwistCMV
(Plasmid
#200228)
-
PurposeExpresses mouse Acidic Mammalian Chitinase catalytic domain with C-terminal 6xHis tag in pTwist CMV vector
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 200228 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepTwist CMV
- Backbone size w/o insert (bp) 4197
- Total vector size (bp) 5391
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAcidic Mammalian Chitinase
-
Alt namemAMCase
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1173
-
MutationS354F
-
GenBank IDNC_000069.7
-
Entrez GeneChia1 (a.k.a. 2200003E03Rik, AMCase, Chia, YNL)
- Promoter CMV
-
Tag
/ Fusion Protein
- 6xHis (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (not destroyed)
- 3′ cloning site NheI (not destroyed)
- 5′ sequencing primer CAGAGCTGGTTTAGTGAACC
- 3′ sequencing primer TCATGTCTGTGAGCTGAAGG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byTwist Biosciences
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2023.06.03.542675 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
mAMCase_CatD_6xHis_pTwistCMV was a gift from James S Fraser (Addgene plasmid # 200228 ; http://n2t.net/addgene:200228 ; RRID:Addgene_200228) -
For your References section:
Structural characterization of ligand binding and pH-specific enzymatic activity of mouse Acidic Mammalian Chitinase. Diaz RE, Ecker AK, Correy GJ, Asthana P, Young ID, Faust B, Thompson MC, Seiple IB, Van Dyken S, Locksley RM, Fraser JS. Elife. 2024 Jun 17;12:RP89918. doi: 10.7554/eLife.89918. 10.7554/eLife.89918 PubMed 38884443