Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

sgRNA5 _1xCTS-ECFP-pA
(Plasmid #200241)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 200241 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    p035_pause-HBG-CFP-pA
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    sgRNA5_1xCTS
  • Species
    Synthetic

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)
  • 3′ cloning site Unknown (unknown if destroyed)
  • 3′ sequencing primer caccaccccggtgaacagctc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    sgRNA5 _1xCTS-ECFP-pA was a gift from Tatjana Sauka-Spengler (Addgene plasmid # 200241 ; http://n2t.net/addgene:200241 ; RRID:Addgene_200241)
  • For your References section:

    Specific Modulation of CRISPR Transcriptional Activators through RNA-Sensing Guide RNAs in Mammalian Cells and Zebrafish Embryos. Pelea O, Mayes S, Ferry QRV, Fulga TA, Sauka-Spengler T. bioRxiv 2023.05.08.539738 10.1101/2023.05.08.539738