sgRNA1 _8xCTS-ECFP-pA
(Plasmid
#200243)
-
PurposeMammalian transfections; 8xCTS-ECFP reporter construct 1
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 200243 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneP2-ECFP-pA (Addgene #26280)
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesgRNA1_8xCTS
-
SpeciesSynthetic
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
- 3′ cloning site Unknown (unknown if destroyed)
- 3′ sequencing primer caccaccccggtgaacagctc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2023.05.08.539738v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
sgRNA1 _8xCTS-ECFP-pA was a gift from Tatjana Sauka-Spengler (Addgene plasmid # 200243 ; http://n2t.net/addgene:200243 ; RRID:Addgene_200243) -
For your References section:
Specific Modulation of CRISPR Transcriptional Activators through RNA-Sensing Guide RNAs in Mammalian Cells and Zebrafish Embryos. Pelea O, Mayes S, Ferry QRV, Fulga TA, Sauka-Spengler T. bioRxiv 2023.05.08.539738 10.1101/2023.05.08.539738