pBAC-ie1-DsRed-ObirOrco-QF2-15xQUAS-GCaMP6s
(Plasmid
#200400)
-
PurposeExpresses DsRed broadly, expresses QF2 and GCaMP6s in OSNs of the clonal raider ant
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 200400 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepXL-BACII-DsRed
-
Backbone manufacturerPotter Lab
- Backbone size w/o insert (bp) 4000
- Total vector size (bp) 12025
-
Vector typeInsect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameDiscosoma red fluorescent protein
-
Alt nameDsRed
-
SpeciesDiscosoma sp.
-
Insert Size (bp)678
- Promoter ie1 (baculovirus)
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer GCTGCAGAACACGCAGCTAG
- 3′ sequencing primer CCCTCCATGCGCACCTT (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameQ factor 2
-
Alt nameQF2
-
SpeciesNeurospora crassa
-
Insert Size (bp)1056
- Promoter ObirOrco (Oocearaea biroi Orco promoter/enhancer fragment)
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer GATGCAGAAGAAGACCATG
- 3′ sequencing primer CCTGATAAGTGCAGGAC (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert nameGCaMP6s
-
Alt nameGCaMP3-K78H T302L R303P D380Y T381R S383T R392G
-
Alt nameGCaMP3 variant 641
-
SpeciesR. norvegicus (rat), G. gallus (chicken); ; A. victoria (jellyfish)
-
Insert Size (bp)1353
- Promoter 15x QUAS
Cloning Information for Gene/Insert 3
- Cloning method Gibson Cloning
- 5′ sequencing primer GCTAAACAATCTGCAGTAAAG
- 3′ sequencing primer CATGTTCTACTTACGTGATAAC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byie1 was cloned from Zach Adelman (Addgene #52894); DsRed & QF2 from Chris Potter (Addgene #104877); 15xQUAS from Chris Potter (Addgene #104875); GCaMP6s from Douglas Kim and GENIE Project (Addgene #40753)
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBAC-ie1-DsRed-ObirOrco-QF2-15xQUAS-GCaMP6s was a gift from Daniel Kronauer (Addgene plasmid # 200400 ; http://n2t.net/addgene:200400 ; RRID:Addgene_200400) -
For your References section:
Sparse and stereotyped encoding implicates a core glomerulus for ant alarm behavior. Hart T, Frank DD, Lopes LE, Olivos-Cisneros L, Lacy KD, Trible W, Ritger A, Valdes-Rodriguez S, Kronauer DJC. Cell. 2023 Jul 6;186(14):3079-3094.e17. doi: 10.1016/j.cell.2023.05.025. Epub 2023 Jun 14. 10.1016/j.cell.2023.05.025 PubMed 37321218