Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pBAD-mTagBFP2
(Plasmid #34632)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 34632 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    mTagBFP2
  • Insert Size (bp)
    738
  • Mutation
    I174A compared to mTagBFP (enhanced photostability and chromophore chemical stability)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BglII (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer 5' atgccatagcatttttatcc 3'
  • 3′ sequencing primer 5' GAT TTA ATC TGT ATC AGG CTG 3'
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBAD-mTagBFP2 was a gift from Vladislav Verkhusha (Addgene plasmid # 34632 ; http://n2t.net/addgene:34632 ; RRID:Addgene_34632)
  • For your References section:

    An enhanced monomeric blue fluorescent protein with the high chemical stability of the chromophore. Subach OM, Cranfill PJ, Davidson MW, Verkhusha VV. PLoS One. 2011;6(12):e28674. Epub 2011 Dec 8. 10.1371/journal.pone.0028674 PubMed 22174863